$0.004
per call · USD Coin on Base
Compares one guide with caller-supplied candidate protospacers, weights mismatches in the guide’s final ten positions twice, applies a simple NGG PAM penalty, and ranks a transparent similarity score. It does not search a genome, model bulges, chromatin or nuclease-specific biology, and must not be used as a clinical or laboratory safety decision.
Endpoint
POST https://bio.halowerk.com/v1/crispr-offtarget1
Calls / 30d
1
Unique payers / 30d
Sep 1
Last called
exact
Payment scheme
Call this service
import { wrapFetchWithPayment } from "@x402/fetch";
import { privateKeyToAccount } from "viem/accounts";
const account = privateKeyToAccount(process.env.PRIVATE_KEY);
const fetchWithPay = wrapFetchWithPayment(fetch, account);
const res = await fetchWithPay("https://bio.halowerk.com/v1/crispr-offtarget", {
method: "POST",
headers: { "Content-Type": "application/json" },
body: JSON.stringify({
"candidates": [
{
"id": "candidate-1",
"pam": "AGG",
"protospacer": "GAGTCCGAGCAGAAGAAGAA"
},
{
"id": "candidate-2",
"pam": "TGG",
"protospacer": "GAGTCCGAGCAGAAGATGAA"
},
{
"id": "candidate-3",
"pam": "TGA",
"protospacer": "GACTCCGAGCAGAAGAAGAT"
}
],
"guide": "GAGTCCGAGCAGAAGAAGAA"
}),
});
const data = await res.json();curl -X POST \
"https://bio.halowerk.com/v1/crispr-offtarget" \
-H "Content-Type: application/json" \
-d '{"candidates":[{"id":"candidate-1","pam":"AGG","protospacer":"GAGTCCGAGCAGAAGAAGAA"},{"id":"candidate-2","pam":"TGG","protospacer":"GAGTCCGAGCAGAAGATGAA"},{"id":"candidate-3","pam":"TGA","protospacer":"GACTCCGAGCAGAAGAAGAT"}],"guide":"GAGTCCGAGCAGAAGAAGAA"}' \
-H "X-PAYMENT: <signed x402 payment>"Payment details
0x2880edfff13100677bf97a3cbdf3bc34771c4e5eUSD Coin · 0x833589fcd6edb6e08f4c7c32d4f71b54bda02913Is this your API?
Pin it to the top of Other and the homepage with a featured placement.
More from Halowerk & similar services
Halowerk · LLM Catalog
modell.halowerk.com
A comparison table of language models: input, output and cache prices per million tokens, context window, maximum output length, batch discount and a short note on what each is suited to. Filter by vendor, by a maximum price, by the context window you need, or by capability tag. Every row carries the date its prices were last checked, so a stale figure is visible rather than silently wrong.
Halowerk · EV Charging
karte.halowerk.com
Queries OpenStreetMap for charging stations within a radius of a point and returns each with its position, distance, operator, network, connector types with their individual power ratings and socket counts, access restrictions, fee status, opening hours and whether authentication is required. Results are sorted nearest first and can be filtered to a minimum power or a required connector type, which is the question a vehicle actually has.
Halowerk · Inverter Load Check
solar.halowerk.com
Continuous load is the sum of the running watts of all appliances marked as simultaneous. The surge check adds the largest single starting surge on top of the continuous load, which is the case that trips an inverter; simultaneous starts of two motors are reported separately as a second figure. Starting factors and power factors are design rules of thumb per appliance class and are stated in the response, they are not device data.